DNA, Human genome, Personal genomics

DNA stands for DEO XYRIBONUCLEIC ACID DNA comprises of adenine cytosine 4 | bases/nucleotides thymine guanine DNA is double stranded - A pairs with T, G pairs with C STRAND 1 - ATGCCGAGCGATCAGTGACGATCGATCGATCGGATCGATCGATGGATCG STRAND 2 - TACGGCTCGCTAGTCACTGCTAGCTAGCTAGCCTAGCTAGCTACCTAGC contains 3,000,000,000 1 base pairs requires assembled human 750 MB genome storage compact disc INDIA WILL REQUIRE 1,210,193,422 compact discs IF EVERY INDIAN'S GENOME WAS SEQUENCED *2011 can hold DNA of all organisms that have ever lived on the earth teaspoon The human genome comprises of 46 88 88 8X 88 88 8 chromosomes [23 pairs] Chromosomal DNA is neatly packaged in -10° cells Human DNA when stretched is Travel from earth to sun 113 610 billion miles times PERSONAL GENOMICS RISKS TO DISEASES BENEFITS RESPONSE TO DRUGS TRAIT INFORMATION WHOLE GENOME SEQUENCING WHOLE GENOME GENOTYPING METHODS COST $15000-$20000 -$300 - $900 -0.03% of the entire COVERAGE Entire genome genome Provide Saliva sample Ship it Order View your report your kit HOW? Personalized report XCODE LIFE SCIENCES - WWW.XCODE.IN